Greetings, fellow scientists! This article will walk through the method we use in my lab for knocking out genes in Enterococcus faecium and Enterococcus faecalis.

Briefly, we use a plasmid with a few key elements; including an antibiotic selection marker and a sequence consisting of a promoter, CRISPR spacer, and the upstream and downstream regions of the gene to be deleted, with an optional insert in between the US and DS regions. The insert can be used to detect the presence of your mutant via qPCR if desired.

I’ll point out where you can adapt this method to your own bug where applicable.

Designing the plasmid

Our plasmid backbone includes the following elements:

• An origin of replication (for replicating the plasmid in E. coli)
• A tetracycline-inducible promoter (for triggering the process of swapping the gene of interest on the chromosome with the gene-less sequence on the plasmid)
• An antibiotic selection marker (for maintaining the plasmid in E. coli or E. faecium/faecalis, e.g. gentamycin, erythromycin)

You may have access to a similar plasmid that you could use; as long as you have something that fulfills each of the above functions, this method should work for you.

The sequence is assembled (US region + insert + DS region) in SnapGene, then ordered from Twist Biosciences, who will generate it and send it to you. Alternatively, you could use SOE (splicing by overlap extension) PCR to generate the sequence yourself- described here.

The sequence will consist of the following elements, in order from 5′ to 3′:

• P3 promoter: CATTCTACAGTTTATTCTTGACATTGCACTGTCCCCCTGGTATAATAACTAT
• First repeat: AATTTCTACTCTTGTAGAT
• CRISPR target
  • Identified by finding a region near the beginning of the gene of interest with three or more T nucleotides followed by any nucleotide (e.g. TTTV, TTTTV, TTTTTV
  • The 23 base pairs immediately following that sequence is the CRISPR target
• Second repeat: AATTTCTACTCTTGTAGAT
• US region for gene of interest (~500 bp)
• qPCR-selectable marker (optional)
  • To generate the qPCR marker, go to this website (https://faculty.ucr.edu/~mmaduro/random.htm), set the size to 90 bp and the GC content to 0.5.
• DS region for gene of interest (~500 bp)

To complete this sequence, tags must be added to the 5′ and 3′ ends which are complementary to the ends of your plasmid backbone. This will make it possible to generate the overlapping ends necessary for insertion into the plasmid backbone.

Desiging all necessary primers

To design primers to check for clean deletion of your gene at the end of this process:

• Select a region of the genome encompassing >500 bp upstream and downstream of the US and DS arms of the gene of interest and copy and paste into Primer3 (https://www.primer3plus.com/)
• To force Primer3 to pick primers that fall on either side of the US and DS arms, specify the locations of the left and right primer as follows (https://www.primer3plus.com/primer3plusHelp.html#SEQUENCE_PRIMER_PAIR_OK_REGION_LIST)
  • For example, if the regions on either side of the US and DS arms are 500 bp long, and the middle region (including the US and DS arms and the gene of interest) is 1500 bp long, then you would enter the following into the ‘Pair OK Region List’ box: 1, 500, 2001, 500
• Check primers against the genome and the insert to double check they hit only on the genome and not on the insert

To design primers for selection of your mutant via qPCR, you need only copy and paste the randomly generated marker into IDT’s PrimerQuest tool (https://www.idtdna.com/PrimerQuest/Home/Index)

Your primers should arrived in lyophilized (dry powder) form. After you have your primers:

• Resuspend lyophilized insert to 50 ng/ul in low EDTA buffer (so that it doesn’t chelate all the metal ions in the PCR and prevent the PCR from working)
  • Elution buffer from Zyppy plasmid prep kit works for this purpose
• Spin down resuspended primers for ~7 seconds (hold down button) in microcentrifuge
• Resuspend in water to 100 uM (approximate this by looking at the nmol number, moving the decimal point one place to the right, then adding that amount of water in uL) to make stocks
• Add 10 ul of this to 90 uL water to make working stocks to be used in PCR

PCR to remove tags from ends of sequence and create overlapping ends with the linearized plasmid backbone

Reaction Setup:

Component	20 µl Reaction
VWR Fast HiFi DNA Polymerase 2X Master Mix	10 µl
10 µM primer 1	1 µl
10 µM primer 2	1 µl
Template- insert	0.5 µl
Nuclease-Free Water	7.5 ul (to 20 µl)

Thermocycling Conditions:

STEP	TEMP	TIME
Initial Denaturation	98°C	30 seconds
25 Cycles	98°C	8 seconds
	65°C	20 seconds
	72°C	1 minute
Final Extension	72°C	4 minutes
Cooldown	22°C	22 seconds

Check results by running PCR product on 1% agarose gel at 110 V for 30 mins

PCR to linearize plasmid backbone

Protocol for Q5® High-Fidelity 2X Master Mix

Reaction Setup:

Component	50 µl Reaction
Q5 or VWR Fast HiFi DNA Polymerase 2X Master Mix	25 µl
10 µM primer 1	2.5 µl
10 µM primer 2	2.5 µl
Template- circular plasmid	1 µl
Nuclease-Free Water	19 ul (to 50 µl)

• First dilute plasmid to 5% (1 µl plasmid + 19 µl nuclease-free water)

Thermocycling Conditions:

PCR program:

STEP	TEMP	TIME
Initial Denaturation	98°C	30 seconds
19 Cycles	98°C	7 seconds
	72°C	3 minutes 50 seconds + 8 seconds/cycle
Final Extension	72°C	2 minutes
Hold	22°C

DpnI treatment (to digest methylated DNA, which should target only the circular plasmid backbone and not the linearized backbone generating during PCR). In a PCR tube:

• 20 ul DNA

• 1 ul DpnI (add last)

• 5 ul rcutsmart buffer

• 24 ul water

Incubate at 37°C for 60 mins, 80°C for 20 mins

Run backbone on 0.8% gel (0.32 g agarose + 40 mL 1x LAB buffer) at 110 V for 40 mins

• A lower percentage gel is better for larger sequences as it can move farther down the gel and is thus more easily distinguished

Assemble plasmid using in vivo cloning

• Use NEB’s ligation calculator (https://nebiocalculator.neb.com/#!/ligation) to determine the amounts of insert and vector (backbone) required
  • Enter vector mass as 100-150 ng
  • The vector:insert molar ratio should be 1:2
• Once insert and vector volumes have been calculated, add them to a PCR tube
  • If you have access to NEBuilder HiFi DNA assembly master mix:
    • Add deionized water to bring the volume to 10 uL and then add 10 u of the mix
    • Mix thoroughly by pipetting and then incubate in a thermocycler for 15 minutes at 50°C
    • Following incubation, store samples on ice or at -20°C for subsequent transformation.

Transformation Protocol:

1. Pre-warm 3 LB plates containing your selection antibiotic
2. Thaw three tubes of chemically competent E. coli cells on ice.
   • One for assembled product, one with digested backbone as negative control, and one with circular backbone as positive control

3. Add 2 ul of assembled product to the cell mixture. Carefully flick the tube 4-5 times to mix cells and DNA. Do not vortex.
4. Place the mixture on ice for 30 minutes. Do not mix.
5. Heat shock at exactly 42°C for exactly 30 seconds. Do not mix.
6. Place on ice for 5 minutes. Do not mix.
7. Pipette 950 µl of room temperature NEB 10-beta/Stable Outgrowth Medium into the mixture.
8. Place at 37°C for 60 minutes. Shake vigorously (250 rpm) or rotate.
9. Warm selective plates to 37°C.
10. Centrifuge the cells at 2,000 rpm/2 minutes. 
11. Discard all but ~100 µl supernatant and resuspend pellet.
12. Spread 100 µl of the resuspended pellet onto a selective plate (LB gent) and incubate overnight at 37°C.

Colony PCR to confirm presence of assembled plasmid

Use a pipette tip to patch colonies onto fresh plate before adding to PCR tube.

10 ul reaction:

• 5 ul  Taq

• 0.2 ul primer 1

• 0.2 ul primer 2

• 4.6 ul water

Thermocycler conditions:

STEP	TEMP	TIME
Initial Denaturation	95°C	30 seconds
30 Cycles	95°C	15 seconds
	43°C	15 seconds
	68°C	1 minute 30 seconds
Final Extension	68°C	5 minutes
Cooldown	22°C	22 seconds

Run 1% gel at 110 V for 30 mins

If you have successfully assembled your plasmid:

• Set up overnight culture for plasmid prep and freezer stock
  • 2XYT broth + 20 ug/ml gent
     
• Plasmid prep
  • Recommended to have your plasmid sequenced to double check that it has been assembled correctly
• Check plasmid concentration via Nanodrop
• To make freezer stock of E. coli containing your plasmid: mix 1 mL culture + 100 uL DMSO

Electroporate plasmid into Enterococcus

First you need to make electrocompetent E. faecium or E. faecalis:

First Day-

• First thing in the morning – inoculate one single colony in 5 ml of BHI and incubate during the day at 37°C/250 rpm.
• At the end of the day, transfer 125 µl of the 5 ml BHI culture to 5 ml BHI 300 mM sucrose + 1% or 2% glycine.
  • 1% glycine
    • 250 ul 20% glycine
    • 2.375 ml 2X BHI and 600 mM sucrose
  • 2% glycine
    • 500 ul 20% glycine
    • 2.25 mL 2X BHI and 600 mM sucrose
• Incubate the culture overnight at 37°C (no agitation!).

Second Day-

• Centrifuged the culture for 10 minutes at 3,700 rpm at 4°C.
• Add to the pellet 3 ml of Buffer PSM and mix carefully until it is dissolved.
• Repeat this procedure twice.
• Add 500 μl of PSM (+100 µl 85% glycerol) to the pellet for final suspension.
• Make 50 µl aliquots to store at -80°C or use immediately.

Electroporation Protocol:

• Mix a 50 µl aliquot of the cell suspension with 1 µg of plasmid (≤1 µl per 50 µl cells if elution buffer was used; ≤5 µl per 50 µl cells if water was used). Keep the mixture and an ice-cold electroporation cuvette (2-mm gap) on ice for 20 minutes before electroporation.
  • Use original circular backbone as positive control
  • Chill pipettes and pipette tips in -20°C during this incubation period
• Transfer the mixture into the ice-cold electroporation cuvette (2-mm gap) and transform cells by electroporation at 200Ω, 25µF, 1.25kV. Time constant should be 2-4.
• Immediately after electroporation, add 1 mL ice-cold BHI 300 mM sucrose broth and incubate the cells at 37°C for 2.5 hours.
• Spin at 3000 RPM in bench top centrifuge for 2 min and discard all but ~100 µl supernatant.
• Gently resuspend the pellet and plate all the cells on a pre-warmed selection plate.
• Incubate the agar plate overnight at 37°C or at RT over weekend

Colony PCR to check for presence of plasmid

Use a pipette tip to patch colonies onto fresh plate before adding to PCR tube

10 uL reaction:

• 5 ul  Taq

• 0.2 ul primer 1

• 0.2 ul primer 2

• 4.6 ul water

Thermocycler conditions:

STEP	TEMP	TIME
Initial Denaturation	95°C	30 seconds
30 Cycles	95°C	15 seconds
	43°C	15 seconds
	68°C	1 minute 30 seconds
Final Extension	68°C	5 minutes
Cooldown	22°C	22 seconds

Run 1% gel at 110 V for 30 mins

If you have successfully electroporated your plasmid into your strain, streak a colony containing the plasmid onto a plate with both the antibiotic selection marker and anhydrous tetracycline (ahTC) to activate the tetracycline-inducible promoter and swap out the gene of interest with the gene-less sequence on the plasmid.

Colony PCR to check for clean deletion

Thermocycling conditions:

STEP	TEMP	TIME
Initial Denaturation	95°C	30 seconds
30 Cycles	95°C	15 seconds
	Use NEB Tm calculator to determine annealing temp of primers*	15 seconds
	68°C	3 minutes
Final Extension	68°C	5 minutes
Cooldown	22°C	22 seconds

* https://tmcalculator.neb.com/#!/main  

Run 1% gel at 110 V for 30 mins

Once the deletion is confirmed, patch an appropriate colony onto a plate without the antibiotic so that the mutant will lose the plasmid.

The colony PCR to check for plasmid loss is the same as to check for the presence of the plasmid, but this time you obviously do not want to see a band on your gel.

It may be necessary to patch multiple times and/or subculture a colony overnight and streak it out again.

Confirm presence of qPCR-selectable marker (if applicable)

Thermocycler conditions:

STEP	TEMP	TIME
Initial Denaturation	95°C	30 seconds
30 Cycles	95°C	15 seconds
	62°C	15 seconds
	68°C	1 minute
Final Extension	68°C	5 minutes
Cooldown	22°C	22 seconds

Run 1% gel at 110 V for 30 mins

Once plasmid loss, clean deletion, and presence of qPCR marker have all been confirmed, you should make a freezer stock of your mutant before using it in any downstream experiments.

And that’s it! Nice and easy, right? Feel free to comment on this article if you have any questions about this method.